View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5839_high_21 (Length: 250)
Name: NF5839_high_21
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5839_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 8141657 - 8141429
Alignment:
| Q |
1 |
atttcaaattagagattacaatatagttattgtggtttcaaagttcgcatttatctgcgatttgttatgatatagagaatcacaacgtaactgcaactgc |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8141657 |
atttcaaattaaagattacaatatagttattgtggcttcaaaggtcgcatttatctgcgatttgttatgatatagagaatcacaacgtaactgcaactgc |
8141558 |
T |
 |
| Q |
101 |
aatttaaatcttcgatctatggtgtgaaaaaattggtgtatactactacatttgtgaagaatcggagaagcaacaaaaaacaaacaacgaaatcacgagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8141557 |
aatttaaatcttcgatctatggtgtgaaaaaattggtgtata---ctacatttgtgaagaatc-gagaagcaacaaaaaacaaacaacgaaatcacgagg |
8141462 |
T |
 |
| Q |
201 |
nnnnnnnnntcataccgagggaccaatagatac |
233 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
8141461 |
aaaaaaaaatcataccgagggaccaatggatac |
8141429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University