View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5839_high_24 (Length: 242)
Name: NF5839_high_24
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5839_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 140 - 226
Target Start/End: Complemental strand, 7776686 - 7776600
Alignment:
| Q |
140 |
gtatgtatcatgtctactttaatgggttgtgtggcagaagcatgcttcgtgtctactttagtgggttgactagcataagcatgcttc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7776686 |
gtatgtatcatgtctactttaatgggttgtgtggcagaagcatgcttcgtgtctacgttagtgggttgactagcataagcatgcttc |
7776600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University