View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5839_low_21 (Length: 290)
Name: NF5839_low_21
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5839_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 8141705 - 8141880
Alignment:
| Q |
1 |
caatatcatacaatgttttgggttatttcttacctacggtaatcaagcaaaaatttttggttgtgcagactgatttaacttggctctatgtctatccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8141705 |
caatatcatacaatgttttgggttatttcttacctaaggtaatcaagcaaaactttttggttgtgcagactgatttgacttggctctatgtctatccaaa |
8141804 |
T |
|
| Q |
101 |
gggaattcatgatcttgttacacacat-aaaaatgtatacaacaatccaccagtgtacattactgaaaatggtaaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8141805 |
gggaattcatgatcttgttacacacataaaaaatgtatacaacaatccaccagtgtacattactgaaaatggtaaa |
8141880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 45 - 174
Target Start/End: Original strand, 8166008 - 8166139
Alignment:
| Q |
45 |
aagcaaaaatttttggt-tgtgcagactgatttaacttggctctatgtctatccaaagggaattcatgatcttgttacacacataaaa-atgtatacaac |
142 |
Q |
| |
|
|||||||| ||| |||| ||||||||| ||||| | ||||| || |||||||| |||||||||||| ||||||| |||||||| ||| || |||||| |
|
|
| T |
8166008 |
aagcaaaactttatggtctgtgcagacggatttgaactggctatacgtctatccgaagggaattcatcatcttgtgacacacatcaaagatacatacaag |
8166107 |
T |
|
| Q |
143 |
aatccaccagtgtacattactgaaaatggtaa |
174 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
8166108 |
aatccaccagtctacattactgaaaatggtaa |
8166139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University