View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5840_high_20 (Length: 266)
Name: NF5840_high_20
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5840_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 31509574 - 31509825
Alignment:
| Q |
1 |
ttttggagttagtagtttgatgattatggagaatgaggctgagaagattcaatctgcacatcgaagattagaagctttggtggtggctattgaaggaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31509574 |
ttttggagttagtagtttgatgattatggaaaatgaggctgagaagattcaatctgcacatggaagattagaagctttggtggtggctattgaaggaatt |
31509673 |
T |
 |
| Q |
101 |
gaaaatggattagaatgtttgtttaagagattgattaatactcgtgtgtcttttttaaatattatttctcc----ttaatatggattatgaattcatatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
31509674 |
gaaaatggattagaatgtttgtttaagagattgattaatactcgtgtgtcttttttaaatattatttctccttaattaatatggattatgaaatcatatt |
31509773 |
T |
 |
| Q |
197 |
atagggatgatattttccaaatgtacagattgtcagattacacatgattttg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31509774 |
atagggatgacattttccaaatgtacagattgtcagattacacatgattttg |
31509825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 171
Target Start/End: Complemental strand, 9277836 - 9277754
Alignment:
| Q |
89 |
attgaaggaattgaaaatggattagaatgtttgtttaagagattgattaatactcgtgtgtcttttttaaatattatttctcc |
171 |
Q |
| |
|
|||||||| ||||||||||||| || |||||||||||| | ||||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
9277836 |
attgaagggtttgaaaatggattggattgtttgtttaagcaccttattaatactcgtgtgtcttttcttaatattctttctcc |
9277754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University