View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5840_low_22 (Length: 257)
Name: NF5840_low_22
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5840_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 19493164 - 19493346
Alignment:
| Q |
17 |
atatcatacctataataacaactagtttaaattgataattaaaactaacctaagcgaataacgctgaaacgttaccgaactgggagtagtatatacatat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19493164 |
atatcatacctataataacaactagtttaaattgataattaaaactaacctaagcgaataacgctgaaacgttaccgaactaggagtagtatatacatat |
19493263 |
T |
 |
| Q |
117 |
ctattacgtattacttcaccatcacatttctcgtcaaactatccttctctcacaaacaaaccctagcaatgactttccctcaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19493264 |
ctattacgtattacttcaccatcacatttctcgtcaaactatccttctctcacaaacaaaccctagcaatgactttctctcaa |
19493346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 216 - 245
Target Start/End: Original strand, 19493362 - 19493391
Alignment:
| Q |
216 |
accctagcaatgactttgtctccaacttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19493362 |
accctagcaatgactttgtctccaacttct |
19493391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University