View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5841-Insertion-16 (Length: 44)
Name: NF5841-Insertion-16
Description: NF5841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5841-Insertion-16 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.000000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 9 - 44
Target Start/End: Original strand, 474081 - 474116
Alignment:
| Q |
9 |
tataccgtagtgcttttgcaaccatttttcttgctc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
474081 |
tataccgtagtgcttttgcaaccatttttcttgctc |
474116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.0000000006
Query Start/End: Original strand, 9 - 44
Target Start/End: Original strand, 466615 - 466650
Alignment:
| Q |
9 |
tataccgtagtgcttttgcaaccatttttcttgctc |
44 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
466615 |
tataccgtagtgcttttgcaaccattgttcttgctc |
466650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 11 - 44
Target Start/End: Original strand, 445817 - 445850
Alignment:
| Q |
11 |
taccgtagtgcttttgcaaccatttttcttgctc |
44 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
445817 |
taccgtaatgcttttgcaaccatttttcttgctc |
445850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University