View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5841-Insertion-9 (Length: 330)
Name: NF5841-Insertion-9
Description: NF5841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5841-Insertion-9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 9 - 330
Target Start/End: Complemental strand, 4624666 - 4624354
Alignment:
| Q |
9 |
cttgcaaatgtcactctcactttttggaatttggttattaccatcccttgatagggaatggatttggggaaggagagttaacattaacaacctttcaagt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4624666 |
cttgcaaatgtcactctcactttttggaatttggttactaccatcccttgatagggaatggagttggggaaggagagttaacattaacaaccttgcaagt |
4624567 |
T |
|
| Q |
109 |
tgtttggtatcatgtaccaaatttgatttgaccagattgatttggtgtttggttattgtcagaatcaattttggttcatttcttttatttctttgaaagg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4624566 |
tgtttggtatcatgtaccaaatttgatttgaccagattgttttggtgtttggttattgtcagaatcaattttggttcattt---------ctttgaaagg |
4624476 |
T |
|
| Q |
209 |
gatatcttgaggtgtggtcaaaacattaacaatttcacagttattattacatgtaagtattcaactaaaagtaaaattttgccgaatttgcgggacagga |
308 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4624475 |
gatatcttgaggtgtggccaaaacattaacaatttcacagttattattacatgtaagtattcaactaaaagtaaaattttgccgaatttgcgggacagga |
4624376 |
T |
|
| Q |
309 |
acatgtcagcatcttagttcga |
330 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
4624375 |
acatgttggcatcttagttcga |
4624354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 24092902 - 24092853
Alignment:
| Q |
9 |
cttgcaaatgtcactctcactttttggaatttggttattaccatcccttg |
58 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| | |||||||||||| |
|
|
| T |
24092902 |
cttgcaaatgtcactctcactttttagaagttggtaactaccatcccttg |
24092853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University