View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5841_high_11 (Length: 264)
Name: NF5841_high_11
Description: NF5841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5841_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 49396064 - 49395816
Alignment:
| Q |
1 |
aaggattaagttattatgaagggaagaaggaatattcaattctattagacaatttttgtaggctaaatatatggttgttggatcaggttaatgtccgtag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49396064 |
aaggattaagttattatgaagggaagaaggaatattcaattctattagacaatttttgtaggctaaatatatggttgttggatcaggttgatgtccgtag |
49395965 |
T |
|
| Q |
101 |
cnnnnnnnacttccattctatttaatactatatttttctttgcttnnnnnnntagttggnnnnnnnnnnnnnnnnnngtacgatgactttatcagtattt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
49395964 |
ctttttttacttccattctatttaatactatatttttctttgcttaaaaaaatagttggtttttaatttaattttttgtacgatgactttatctgtattt |
49395865 |
T |
|
| Q |
201 |
cctagcatacattgtgatccagcattgtcaacttgcgagtgccagctct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49395864 |
cctagcatacattgtgatccagcattgtctacttgcgagtgccagctct |
49395816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University