View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5842-Insertion-4 (Length: 345)
Name: NF5842-Insertion-4
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5842-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 326; Significance: 0; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 9 - 342
Target Start/End: Original strand, 30325523 - 30325856
Alignment:
| Q |
9 |
ctcaactccatcaacccagatttcccatggaccactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325523 |
ctcaactccatcaacccagatttcccatggaccactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttc |
30325622 |
T |
|
| Q |
109 |
attttcttcagtatcgcaaatttaaatcacacattgaacaacttcactttggcaactacgtttttgatgaaagaccgaccctactaccatgttcttccca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30325623 |
attttcttcagtatcgcaaatttaaatcacacattgaacaacttcactttggcaactacgtttttgatgaaagaccaaccctactaccatgttcttccca |
30325722 |
T |
|
| Q |
209 |
taatgccactctcaacccacttctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaacccagaaaaccccattaacctc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325723 |
taatgccactctcaacccacttctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaacccagaaaaccccattaacctc |
30325822 |
T |
|
| Q |
309 |
tctctttccccttttcctccatctctagaacatc |
342 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
30325823 |
tctctttcccctttccctccatctctagaacatc |
30325856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 9 - 128
Target Start/End: Original strand, 30337160 - 30337279
Alignment:
| Q |
9 |
ctcaactccatcaacccagatttcccatggaccactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
30337160 |
ctcaactccatcaacccagatttcccatggacaactcgcttctccggcgacctctgtcgcttacccccacccggcgttgtttgccgttactcctactttc |
30337259 |
T |
|
| Q |
109 |
attttcttcagtatcgcaaa |
128 |
Q |
| |
|
|| ||||| ||||||||||| |
|
|
| T |
30337260 |
atcttcttaagtatcgcaaa |
30337279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 230 - 288
Target Start/End: Original strand, 30337381 - 30337439
Alignment:
| Q |
230 |
tctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaacc |
288 |
Q |
| |
|
||| |||||||||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
30337381 |
tcttttcacccctttcaactaccttggaaaactcatcttccgtgaatgcttcaacaacc |
30337439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 219 - 287
Target Start/End: Original strand, 30332972 - 30333040
Alignment:
| Q |
219 |
ctcaacccacttctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaac |
287 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
30332972 |
ctcaacccaatactcttaacccctttcaactacctccgcaaactcacattccacaaatgcttcaacaac |
30333040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University