View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5842-Insertion-6 (Length: 143)
Name: NF5842-Insertion-6
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5842-Insertion-6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 3e-46; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 37704454 - 37704547
Alignment:
| Q |
8 |
accaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37704454 |
accaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgata |
37704547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 9 - 101
Target Start/End: Original strand, 37698974 - 37699068
Alignment:
| Q |
9 |
ccaaaaaggttgacttattagattgtttgcaaa--ttgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgata |
101 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||| ||||||||| ||||||||||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
37698974 |
ccaaaaagtttgagttattagattgtttacaaacattgagtctaggtattcccttattttgtgttgggggtgcttttcataaccgtatactgata |
37699068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 37698636 - 37698697
Alignment:
| Q |
8 |
accaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgtt |
69 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
37698636 |
accaaaaagtttgacttattagattgtttacaaattgagtctaagtattcccttattttgtt |
37698697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 37437520 - 37437612
Alignment:
| Q |
8 |
accaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgata |
101 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||| |||||| ||||||||| |||| | | |||||||||||||||| | |||| ||||| |
|
|
| T |
37437520 |
accaaaaagtctgacttattagattgtttacaaattcagtctagctattcccttgttttaatgt-ggggtgcttttcataaccgtatagtgata |
37437612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University