View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5843-Insertion-2 (Length: 70)
Name: NF5843-Insertion-2
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5843-Insertion-2 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 4e-28; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 31492330 - 31492392
Alignment:
| Q |
8 |
actgtggatacccagaggcttatccacatgcatatccaccgaatccaccaacttattcacagg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31492330 |
actgtggatacccagaggcttatccacatgcatatccaccgaatccaccaacttattcacagg |
31492392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 31497719 - 31497781
Alignment:
| Q |
8 |
actgtggatacccagaggcttatccacatgcatatccaccgaatccaccaacttattcacagg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31497719 |
actgtggatacccagaggcttatccacatgcatatccaccgaatccaccaacttattcacagg |
31497781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 31503106 - 31503168
Alignment:
| Q |
8 |
actgtggatacccagaggcttatccacatgcatatccaccgaatccaccaacttattcacagg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31503106 |
actgtggatacccagaggcttatccacatgcatatccaccgaatccaccaacttattcacagg |
31503168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University