View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5843-Insertion-4 (Length: 328)
Name: NF5843-Insertion-4
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5843-Insertion-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 326
Target Start/End: Original strand, 5535986 - 5536284
Alignment:
| Q |
8 |
aaattacataactcaagaatggtttatgataaatctctcttggttgctactctaaaatgcatgcataaactctcatctgtttgcaaccttagagcaaaag |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
5535986 |
aaattacataactcaagaatggttgatgataaatctctcttggttgctactctaaaatgcatgcataaactctcctctgtttgcaaccttagagcaaacg |
5536085 |
T |
|
| Q |
108 |
aagttgaggatgttaaatctgatttattatttcatagttcaccttttatattaatgttaatggtgaacaatttttaacattttcttaaataaaaatgaag |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||| |
|
|
| T |
5536086 |
gagttgaggatgttaaatatgatttattatttcatagttcaccttttatattaatgttaatggtgaacagtttttaacattttattaaataaaaataaag |
5536185 |
T |
|
| Q |
208 |
gttggggttctattttttcggatctagattcgatttttcgggtctgaaaatcagcttcttcctcttttttaccaaacttcttcatcctcttcttcactgt |
307 |
Q |
| |
|
| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5536186 |
gctggggttcgattttttcgga--------------------tctgaaaatcagcttcttcctcttttttaccaaacttcttcatcctcttcttcactgt |
5536265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 275 - 316
Target Start/End: Complemental strand, 10459974 - 10459933
Alignment:
| Q |
275 |
tttaccaaacttcttcatcctcttcttcactgtttttgttct |
316 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
10459974 |
tttaccaaacttattcatcctgttcttcactgtttttgttct |
10459933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 316
Target Start/End: Original strand, 19737652 - 19737692
Alignment:
| Q |
276 |
ttaccaaacttcttcatcctcttcttcactgtttttgttct |
316 |
Q |
| |
|
|||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
19737652 |
ttaccaaacttcttcatcatgttcttcgctgtttttgttct |
19737692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University