View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5843_high_3 (Length: 238)
Name: NF5843_high_3
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5843_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 59 - 222
Target Start/End: Original strand, 2254763 - 2254926
Alignment:
| Q |
59 |
cacaaacactataaaattagaggactcacctggtttgaaagacctaaacttaaaaccttaactttgctcaactcagcttcaagtattgcttcttctataa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2254763 |
cacaaacactataaaattagaggactcacctggtttgaaagacctaaacttaaaaccttaactttgctcaactcagcttcaagtattgcttcttctataa |
2254862 |
T |
 |
| Q |
159 |
gtttattcaatgtttctctttgccatttaaaaagatactacaaaagtttaaacaaaaacaatat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2254863 |
gtttattcaatgtttctctttgccatttaaaaagatactacaaaagtttaaacaaaaacaatat |
2254926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University