View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5844-Insertion-6 (Length: 310)
Name: NF5844-Insertion-6
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5844-Insertion-6 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 9 - 310
Target Start/End: Original strand, 55075114 - 55075415
Alignment:
| Q |
9 |
ctgcgaatgagattgcttggtggaagagatggaaaaggccaccaaatttttctgtttttcaacccaagggataatctttaaagttgattgtgacttaacc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075114 |
ctgcgaatgagattgcttggtggaagagatggaaaaggccaacaaatttttctgtttttcaacccaagggataatctttaaagttgattgtgacttaacc |
55075213 |
T |
|
| Q |
109 |
tttcacttggcacatgaaagtccatgttatctctccccacaaatcctctcatcaagacaacacattgtaagataaagggccctgtgatatcatgatatcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075214 |
tttcacttggcacatgaaagtccatgttatctctccccacaaatcatctcatcaagacaacacattgtaagataaagggccctgtgatatcatgatatcc |
55075313 |
T |
|
| Q |
209 |
tctcttcacatgaagatgctaacctctactctatccagctagattagtcttctgttgtttggaattttaattgatattagtaattttgtgtggtttctaa |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075314 |
tctcttcacatgaagatgctaacctctactctatccagctagattagtcttctgttgtttgaaattttaattgatattagtaattttgtgtggtttctaa |
55075413 |
T |
|
| Q |
309 |
aa |
310 |
Q |
| |
|
|| |
|
|
| T |
55075414 |
aa |
55075415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 89 - 168
Target Start/End: Complemental strand, 50371291 - 50371212
Alignment:
| Q |
89 |
aagttgattgtgacttaacctttcacttggcacatgaaagtccatgtta-tctctccccacaaatcctctcatcaagacaa |
168 |
Q |
| |
|
|||||||| ||||||| |||||||| ||||||||||||| |||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
50371291 |
aagttgatggtgactttacctttcatttggcacatgaaa-accatgttactctctccccacaattcttctcatcaagacaa |
50371212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University