View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5844_low_5 (Length: 317)
Name: NF5844_low_5
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5844_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 13 - 300
Target Start/End: Original strand, 195242 - 195529
Alignment:
| Q |
13 |
aatatggtactgctcgccgtttttacattcaaacgctagatgatcgtgctctttcaccagatgtccaagagaagcttgtgggggaaaatccacctgaagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195242 |
aatatggtactgctcgccgtttttacattcaaacgctagatgatcgtgctctttcaccagatgtccaagagaagcttgtgggggaaaatccacctgaagg |
195341 |
T |
 |
| Q |
113 |
agttttcaaaatcaaaggcagtgatcattgtccattcttctccaaaccacaatctctccacaaaatattagttgaaatagctcaaattcagtaactagct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195342 |
agttttcaaaatcaaaggcagtgatcattgtccattcttctccaaaccacaatctctccacaaaatattagttgaaatagctcaaattcagtaactagct |
195441 |
T |
 |
| Q |
213 |
taatgatcaacaatacatgatttgttacttttatctttccatctcccaactcaccaaattaaagaatagagttcacatggcccagctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195442 |
taatgatcaacaatacatgatttgttacttttatctttccatctcccaactcaccaaattaaagaatagagttcacatggcccagctg |
195529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University