View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5844_low_9 (Length: 212)
Name: NF5844_low_9
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5844_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 32805520 - 32805701
Alignment:
| Q |
15 |
aatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctctttgtaactccttaatagaagactcggatcaccttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32805520 |
aatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctctttgtaactcctcaatagaagactcggatcaccttt |
32805619 |
T |
 |
| Q |
115 |
ttatgcgctgccctgctgccttagcagtctggttctcttcccctcttgggatccatgtaccggaccaattggagttgatatc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
32805620 |
ttatgcgctgccctgctgccttagcagtctggttctcttcccctcttgggatccatgtaccgaaccaattgaacttgatatc |
32805701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 6095397 - 6095216
Alignment:
| Q |
15 |
aatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctctttgtaactccttaatagaagactcggatcaccttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
6095397 |
aatatccttccaactagaagtaatttgggtaagaaaggtatatccctggatatgagttgtcctctttgtaacttctcaatagaagactcagatcaccttt |
6095298 |
T |
 |
| Q |
115 |
ttatgcgctgccctgctgccttagcagtctggttctcttcccctcttgggatccatgtaccggaccaattggagttgatatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6095297 |
ttatgcgctgccctgctgccttagcagtctggttctcttcccctcttgggatccatgtaccggaccaattggacttgatatc |
6095216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University