View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5845-Insertion-16 (Length: 96)
Name: NF5845-Insertion-16
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5845-Insertion-16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 7005366 - 7005278
Alignment:
| Q |
8 |
agtatgaaattaaataagataggtaagtgttaatttcttgggggagggaacaaaaattcaagcaaatctcttcaactgacactcttatc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7005366 |
agtatgaaattaaataagataggtaagtgttaatttcttgggcgagggaacaaaaattcaagcaaatctcttcaactgacactcttatc |
7005278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University