View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5845_high_21 (Length: 238)
Name: NF5845_high_21
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5845_high_21 |
 |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0152 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 11458 - 11260
Alignment:
| Q |
21 |
aaaaaaccaaaacaacttagaaatagacaaagtcttgccaatttaaatcagtccacacttgcagattatcgttacttcgaacaaccggtgcaccaaacca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
11458 |
aaaaaaccaaaacaacttagaaatagacaaagtcttgccaatttaaatcagtccacacttgcagagtatcgttacttcgaacaaccggtgcacc-aacca |
11360 |
T |
 |
| Q |
121 |
tcacattagaaccttcacaaagcctttctagcaagaaccattcgattgaaaaaccactatcaattttaaactgaacataaggacgtctctcaaagaccag |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11359 |
tcacattagaaccttcacaaagcc-ttctagcaagaaccattcgattg--aaaccactatcaattttaaactgaacataaggacgtctctcaaagaccag |
11263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University