View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5845_high_7 (Length: 380)
Name: NF5845_high_7
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5845_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 8936585 - 8936216
Alignment:
| Q |
1 |
tgcaacacttagatgtgatannnnnnnngagagacttagatgtgatattagttaggtgttctattcttagacaagcatgcattgctaccgtcttacatat |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8936585 |
tgcaacacttagatgtgatatattttttgagagacttagatgtgatattagttaggtgttctcttcttagacaagcatgcattgctaccgtcttacatat |
8936486 |
T |
|
| Q |
101 |
gaaaatggattgtatctaatctgttttatcaaattgctttttctgctatgatggttttgcctgactt-gtaatgtttttctttatatgtgtatggtagat |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
8936485 |
gaaaacggattgtatctaatctgttttatcaaattgctttttctgctatgatggttttgcctgactttgtaatgtttttctttatatgtgtatggttgat |
8936386 |
T |
|
| Q |
200 |
gcatgtctcctttagatggtgatctatgatggtagatgcaataccaaagacgtggtcgtagttaggttctcttcttagacatgcatgtgggtgtcttaga |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8936385 |
gcatgtctcctttagatggtgatctatgatggtagatgcaacaccaaagacgtggtcgtagttaggttctcttcttagacatgcatgtgggtgtcttaaa |
8936286 |
T |
|
| Q |
300 |
tatgaaaaactaatttgtatatggtagatgcatgtcggtgtaagatttcttccctatatacacacccttt |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8936285 |
tatgaaaaactaatttgtatatggtagatgcatgtcggtgtaagatttcttccctatatacacacccttt |
8936216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University