View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5845_low_19 (Length: 251)
Name: NF5845_low_19
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5845_low_19 |
 | |
|
| [»] scaffold0152 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0152 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 11475 - 11719
Alignment:
| Q |
1 |
ttagtaatccctatcttcatttagtattttcattatgttttgtctaacaagttgtatttccttcttaattagtagaagtttgttctctattatatgtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11475 |
ttagtaatccctatcttcatttagtattttcattatgttttgtctaacaagttgtatttccttcttaattagtagaagtttgttctctattatatgttta |
11574 |
T |
|
| Q |
101 |
tactggacccattgatgatgaaatgaagagaagcaatggcctttatgtttcatcattgtctcaatttgcattaatatttattcaagcagtagcatataga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11575 |
tactggacccattgatgatgaaatgaagagaagcaatggcctttatgtttcatcattgtctcaatttgtattaatatttattcaagcagtagcatataga |
11674 |
T |
|
| Q |
201 |
gtaaactggtcgaatttaactcagaatgaacgtgagaattatcta |
245 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11675 |
gtaaactggtcgaatttaacttagaatgaacgtgagaattttcta |
11719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University