View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848-Insertion-12 (Length: 220)
Name: NF5848-Insertion-12
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848-Insertion-12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 6171775 - 6171573
Alignment:
| Q |
9 |
ggagggtctcatatcaagagtaaattagagatgtaaatttgttattgtattttgattggagatggattgtcgaatgaagatgcttagaaaaattgtgaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6171775 |
ggagggtctcatatcaagagtaaattagagatgtaaatttgttattgtattttgattggagatggattgtcgaatgaagatgcttagaaaaattgtgaag |
6171676 |
T |
|
| Q |
109 |
ctatttggtattattgaagtttggtattg-cgaagctgagaagcgtataagtgttactatttggtttgcaatttcttaagtagatggatgtcgcagaaag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
6171675 |
ctatttggtattattgaagtttggtattgttgaagctgagaagcatataagtgttacaatttgttttgcattttcttaagtagatgaatgtcgcagaaag |
6171576 |
T |
|
| Q |
208 |
gac |
210 |
Q |
| |
|
||| |
|
|
| T |
6171575 |
gac |
6171573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University