View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5848-Insertion-16 (Length: 64)

Name: NF5848-Insertion-16
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5848-Insertion-16
NF5848-Insertion-16
[»] chr8 (2 HSPs)
chr8 (9-64)||(1950583-1950638)
chr8 (15-64)||(2028358-2028407)


Alignment Details
Target: chr8 (Bit Score: 56; Significance: 5e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 1950583 - 1950638
Alignment:
9 aaaagtactcctttttagcatctgtatccatctcatgaaacctcttcacaccatcc 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1950583 aaaagtactcctttttagcatctgtatccatctcatgaaacctcttcacaccatcc 1950638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 2028407 - 2028358
Alignment:
15 actcctttttagcatctgtatccatctcatgaaacctcttcacaccatcc 64  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||    
2028407 actcctttttagcatctgtctccatctcatgaaacctcttcacaccatcc 2028358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University