View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848-Insertion-9 (Length: 403)
Name: NF5848-Insertion-9
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848-Insertion-9 |
 | |
|
| [»] chr2 (4 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 1e-75; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 227 - 403
Target Start/End: Original strand, 12730744 - 12730920
Alignment:
| Q |
227 |
attactttttatgttaattccgtgattttagggtttattgctcaaatgggtcattgaatatgaagttcttgctatgaatannnnnnnagcggtttatgtt |
326 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
12730744 |
attaatttttatgttaattccgcgattttagggtttattgctcaaatgggtcattgaatatgaagttcttgctatgaatatttttttagcggtttatgct |
12730843 |
T |
|
| Q |
327 |
caaatgggttattgaatatgaatttcttgctatgaatattctttagtgttttttactcaaatgggttattcttgcta |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12730844 |
caaatgggttattgaatatgaatttcttgctatgaatattctttagtgttttttactcaaatgggttattcttgcta |
12730920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 7 - 123
Target Start/End: Original strand, 12730538 - 12730655
Alignment:
| Q |
7 |
caattagggttttcaatacttcatcaaactcactctattctcttccataatcgcgctacgtaactcaaggtatg-ttttttcgctatgatctagtgattt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12730538 |
caattagggttttcaatacttcatcaaactcactctattctcttccataatcgcgctacgtaactcaaggtatgtttttttcgctatgatctagtgattt |
12730637 |
T |
|
| Q |
106 |
tttggcttaatttgtcaa |
123 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12730638 |
tttggcttaatttgtcaa |
12730655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 302
Target Start/End: Original strand, 12730944 - 12730982
Alignment:
| Q |
264 |
ttgctcaaatgggtcattgaatatgaagttcttgctatg |
302 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12730944 |
ttgctcaaatgggtcattgaatatgaatttcttgctatg |
12730982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 396
Target Start/End: Original strand, 12730948 - 12731020
Alignment:
| Q |
326 |
tcaaatgggttattgaatatgaatttcttgctatgaatattctt--tagtgttttttactcaaatgggttatt |
396 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||| || ||||||||| | || |||||| ||||| |
|
|
| T |
12730948 |
tcaaatgggtcattgaatatgaatttcttgctatgcatattttttctagtgttttatgctgaaatggtttatt |
12731020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University