View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848_high_14 (Length: 389)
Name: NF5848_high_14
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 52 - 376
Target Start/End: Complemental strand, 24042156 - 24041820
Alignment:
| Q |
52 |
gcaacagcactagatgctgctgcttttaccggcttttcatgttcgagcggttttatttctgcggctgctattttcacctgttcaggaggtgtgctctgaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042156 |
gcaacagcactagatgctgctgcttttaccggcttttcatgttcgagcggttttatttctgcggctgctattttcacctgttcaggaggtgtgctctgaa |
24042057 |
T |
|
| Q |
152 |
c------------agaaactttcccacctgcactagactctggtttcgaggaatctgttacagcattttccgctgttgtcggagttttgtttatatcttc |
239 |
Q |
| |
|
| ||||||||||||||| |||| |||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
24042056 |
ccgaaacatgttcagaaactttcccaccagcacaagactccggtttcgaggaacctgttacagcattttccggtgttgtcggagttttgtttttatcttc |
24041957 |
T |
|
| Q |
240 |
ggcattaggaggaggaagccttgcctctggcggacgtgttttccatacggccgcggaaacggattgtaggaaaccaccattgttaccgaggtttggtccc |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24041956 |
ggcattaggaggaggaagccttgcctctggcggacgtgttttccatacggccgcggaaacggattgtaggaaaccaccattgttaccgaggtttggtccc |
24041857 |
T |
|
| Q |
340 |
acacagttgttgcccattgaaaaaacgacgtcgtttc |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24041856 |
acacagttgttgcccattgaaaaaacgacgtcgtttc |
24041820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University