View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848_high_15 (Length: 379)
Name: NF5848_high_15
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 9 - 292
Target Start/End: Original strand, 46104045 - 46104327
Alignment:
| Q |
9 |
gagaagaatgttgctgcaaaatcacaagaatgggggaaagtttctgcagtcttgtttgatatggacggtgttctctgtaacagtgaagaaccttctagaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46104045 |
gagaagaatgttgctgcaaaatcacaagaatgggggaaagtttctgcagtcttgtttgatatggacggtgttctctgtaacagtgaagaaccttctagaa |
46104144 |
T |
 |
| Q |
109 |
gagccggtgttgatttcttcgccgagatcggtgttcaagtcaccgtcgacgattttgttccgttcatgggaactggtacgtatacttgttcagagaaatt |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46104145 |
gatccggtgttgatttcttcgccgagatcggtgttcaagtcaccgtcgacgattttgttccgttcatgggaactggtacgtatacttgttcagagaaatt |
46104244 |
T |
 |
| Q |
209 |
aataaattacttaggtccagttttaatttaattttgagattatacttagttaacaaaccattacattaaattaaatgtggtagc |
292 |
Q |
| |
|
||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46104245 |
aat-aattacttatgtccagttttaatttaattttgagattatacttagttaacaaaccattacattaaattaaatgtggtagc |
46104327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University