View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848_high_23 (Length: 255)
Name: NF5848_high_23
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848_high_23 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 255
Target Start/End: Original strand, 46103683 - 46103930
Alignment:
| Q |
8 |
cgaagaaaattggataaggcaacccttgnnnnnnntatcgctggcagttctttcccaccataacaaacatactatgcgagccagaaattgaaatgaaaac |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
46103683 |
cgaaaaaaattggataaggcaacccttgaaaaaaatatcgctggcagttctttcccaccataacatacatact-tgcaagcgagaaattgaaatgaaaac |
46103781 |
T |
 |
| Q |
108 |
attaaaa-ttgcatgaatgaatttggtggtaatagtaatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccat |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46103782 |
attaaaaattgcatgaatgaatttggtggtaatagtaatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccat |
46103881 |
T |
 |
| Q |
207 |
ggcctttcaaacaacacactcttatctaaccacaacaaacttcatcttc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46103882 |
ggcctttcaaacaacacactcttatctaaccacaacaaacttcatcttc |
46103930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University