View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848_high_26 (Length: 234)
Name: NF5848_high_26
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 52712004 - 52711803
Alignment:
| Q |
18 |
aaacctgcatttcaaatttcctatacttgtgttacaaaattattcaacaaaacatattaggtcc-actaccatttccaccaccaatgctatctttctttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712004 |
aaacctgcatttcaaatttcctatacttgtgttacaaaattattcaacaaaacatattaggtcccactaccatttccaccaccaatgctatctttctttt |
52711905 |
T |
|
| Q |
117 |
ttgtgccaacacttgtagaacaaaaaagcattggatttggaagaggttaagaaccaccattattattaaacaactcaccaccgatactccgccctctcct |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52711904 |
ttgtgcccacacttgtagaacaaaaaagcattggatttggaagagggtaagaaccaccattattattaaacaactcaccaccgatactccgccctctcct |
52711805 |
T |
|
| Q |
217 |
at |
218 |
Q |
| |
|
|| |
|
|
| T |
52711804 |
at |
52711803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 72 - 212
Target Start/End: Complemental strand, 52717260 - 52717123
Alignment:
| Q |
72 |
tattaggtccactaccatttccaccaccaatgctatctttcttttttgtgccaacacttgtagaacaaaaaagcattggatttggaagaggttaagaacc |
171 |
Q |
| |
|
||||||||||| ||||| ||||||| || |||||||||||||| ||||||||| |||||||||||| | ||||||| ||||||||| |||| |||||||| |
|
|
| T |
52717260 |
tattaggtccattaccacttccaccgcccatgctatctttcttctttgtgccagcacttgtagaaccagaaagcataggatttggaggagggtaagaacc |
52717161 |
T |
|
| Q |
172 |
accattattattaaacaactcaccaccgatactccgccctc |
212 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||| ||||| |
|
|
| T |
52717160 |
accat---tattgaacaactcaccactcatactcctccctc |
52717123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University