View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848_high_30 (Length: 228)
Name: NF5848_high_30
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848_high_30 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 228
Target Start/End: Original strand, 1453237 - 1453454
Alignment:
| Q |
9 |
tacatcagtgctttacaagttagttcaattttaccttatatctgttaacaaatgagggaagttatgattttatcaatttatgtttttgctttactactta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1453237 |
tacatcagtgctttacaagttagttcaattttaccttatatctgttaacaaatgagggaagttatgattttatcaatttatgtttttgctttactactta |
1453336 |
T |
|
| Q |
109 |
ttaactgtgtaatagtaaaatctttctaagactctaaggtttcacagaggtatggcttaacattttagaaatgtgtcaggcgcatatgtagtgaaaacaa |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1453337 |
ttaactgtgtaatagt--aatctttctaagactctaaggtttcacagaggaatggcttgacattttagaaatgtgtcaggcgcatatgcagtgaaaacaa |
1453434 |
T |
|
| Q |
209 |
tttttagaatttttaagaat |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1453435 |
tttttagaatttttaagaat |
1453454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University