View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5848_low_21 (Length: 273)
Name: NF5848_low_21
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5848_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 272
Target Start/End: Complemental strand, 52911677 - 52911423
Alignment:
| Q |
17 |
attaaaaaagttagaacaagagtggtgctaaatatgcaactgaaaatttgaaaatgttgcatgaccccctacccattggcttaaagtttaagcaaacctg |
116 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52911677 |
attaaaaaagttaaaacaaaagtggtgctaactatgcaactgaaaatttgaaaatgttgcatggccccccacccattggcttaaagtttaagcaaacctg |
52911578 |
T |
|
| Q |
117 |
ctagtcccaaatttttcaaaccaaaagcactatgcaaaataaatttcaaggtttacctttccagtatcagcgagctcaccccaatcatagttctcacact |
216 |
Q |
| |
|
|| ||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52911577 |
ctcgtcccaaatttatcaaaccaaaaacacta-gcaaaataaatttcaaggtttacctttccagtatcagcgagctcaccccaatcatagttctcacact |
52911479 |
T |
|
| Q |
217 |
ctttcatagcaaactcagcatgcgcttttcgtttcttggaggcttcagtgggcttt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52911478 |
ctttcatagcaaactcagcatgcgcttttcgtttcttggaggcttcagttggcttt |
52911423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 191 - 246
Target Start/End: Complemental strand, 12229604 - 12229549
Alignment:
| Q |
191 |
ctcaccccaatcatagttctcacactctttcatagcaaactcagcatgcgcttttc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12229604 |
ctcaccccaatcatagttctcacactctttcatagcaaactcagcatgcgcttttc |
12229549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University