View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5850-Insertion-6 (Length: 212)
Name: NF5850-Insertion-6
Description: NF5850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5850-Insertion-6 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 70 - 212
Target Start/End: Original strand, 18801361 - 18801503
Alignment:
| Q |
70 |
accttcataaaaccgaataatactgaaattaaatatgagcaagaataaacttcggaaccttattcttcacaatcggtttcttgataaatttcttgatctt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18801361 |
accttcataaaaccgaataatactgaaattaaatatgagcaagaataaacttcggaaccttattcttcacaatcggtttcttgataaatttcttgatctt |
18801460 |
T |
 |
| Q |
170 |
cattccgtttcgcctcttccattgtgcttctctcccaatcacc |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18801461 |
cattccatttcgcctcttccattgtgcttctctcccaatcacc |
18801503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 33 - 79
Target Start/End: Original strand, 18800990 - 18801036
Alignment:
| Q |
33 |
aactgcttcatacaagcttggaaacccacttcatgataccttcataa |
79 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18800990 |
aacttcttcatacaagcttggaaacccacttcatgatactttcataa |
18801036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 9 - 71
Target Start/End: Complemental strand, 18190642 - 18190579
Alignment:
| Q |
9 |
atgaaagcattcaacttcttcataaactgcttca-tacaagcttggaaacccacttcatgatac |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
18190642 |
atgaaagcattcaacttcttcataaactccttcactacaagcttgcaaacccacttcatgatac |
18190579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 150
Target Start/End: Complemental strand, 54016397 - 54016342
Alignment:
| Q |
95 |
aaattaaatatgagcaagaataaacttcggaaccttattcttcacaatcggtttct |
150 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |||| |||| |||||| |
|
|
| T |
54016397 |
aaattaaatatgaagaagaataaactttggaaccttattgttcataatctgtttct |
54016342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 71
Target Start/End: Complemental strand, 20810917 - 20810860
Alignment:
| Q |
11 |
gaaagcattcaacttcttcataaactgcttca-tacaagcttggaaacccacttcatgatac |
71 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
20810917 |
gaaagcattcaacttcttca----ctgcttcactacaaccttgcaaacccacttcatgatac |
20810860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University