View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5851_low_6 (Length: 251)
Name: NF5851_low_6
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5851_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 42063199 - 42063439
Alignment:
| Q |
1 |
tgaactgcatccgctttaccggtaccagtcaccacaagagcaatgtaagcagaggaattgatcacgggaaaggtaaatgttattctctctgggggtggtt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42063199 |
tgaactgcatccgctttgccggtaccagtcaccacaagagcaatgtaagcagaggaattgatcacgggaaaggtaaatgttattctctctgggggtggtt |
42063298 |
T |
|
| Q |
101 |
ttggcgagtcgttaattgaggtgacccattttttattctcatggacaagagggtgacctgggaacagagaagctacatgcccatcaggacccatgccaag |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42063299 |
ttggcgagtcgttaattgaggtaacccattttttattctcatggacaagagggtgacctgggaacagagaagctacatgcccatcaggacccatgccaag |
42063398 |
T |
|
| Q |
201 |
caacatgagatcaaattttggaaatccactggctgatgatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42063399 |
caacatgagatcaaattttggaaatccactggctgatgatg |
42063439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 238
Target Start/End: Original strand, 9514335 - 9514516
Alignment:
| Q |
57 |
attgatcacgggaaaggtaaatgttattctctctgggggtggttttggcgagtcgttaattgaggtgacccattttttattctcatggacaagagggtga |
156 |
Q |
| |
|
||||||||| ||||| || || || |||||||||| ||||||||||| ||||| | | | || |||||||| | || ||| |||| ||||| ||| |
|
|
| T |
9514335 |
attgatcactggaaaagtgaaagtaattctctctgatggtggttttggtgagtcagtgaggaaagtaacccatttctgatcctcttggagaagagcatga |
9514434 |
T |
|
| Q |
157 |
cctgggaacagagaagctacatgcccatcaggacccatgccaagcaacatgagatcaaattttggaaatccactggctgatg |
238 |
Q |
| |
|
|||||||| | ||| || ||||| ||||| |||||||| || || | |||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
9514435 |
cctgggaataaagatgcaacatgtccatccggacccatacctaggagcatgagatcaaattttggtaatccattggttgatg |
9514516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University