View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852-Insertion-12 (Length: 170)
Name: NF5852-Insertion-12
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852-Insertion-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 11402503 - 11402342
Alignment:
| Q |
9 |
gtaataacttcttcctttgccatatatagttgatagaaccaaaattgtttccaccttttggattgaaattgttctctcttttgatcgaagtttccatgtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11402503 |
gtaataacttcttcctttgccatatataattgatagaaccaaaattgtttccaccttttggattgaaattgttctctcttttgatcgaagttttcatgtc |
11402404 |
T |
|
| Q |
109 |
ctctcccatttgattggattcattaatattattgaagttcacttgacttttcaaggcttcct |
170 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11402403 |
ctctcccatttgattggattcattaatgttattgaagttcacttgacttttcaaggcttcct |
11402342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University