View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5852-Insertion-14 (Length: 123)

Name: NF5852-Insertion-14
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5852-Insertion-14
NF5852-Insertion-14
[»] chr7 (2 HSPs)
chr7 (9-123)||(8405775-8405890)
chr7 (73-104)||(8361823-8361854)


Alignment Details
Target: chr7 (Bit Score: 72; Significance: 3e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 9 - 123
Target Start/End: Original strand, 8405775 - 8405890
Alignment:
9 tttaacagttcagatatgcaaaatgaat-gttgtacagccaaatcagatcgtcactaatgaatcgtatcaaccaaacaagtgttgcacaacaaattattt 107  Q
    |||||||||||||||||||| ||||||| | |||| ||||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||||||    
8405775 tttaacagttcagatatgcagaatgaattgctgtatagccaaatcagattgtcactaatgaattgtgtcaaccaaacaagtgttgcacaacaaattattt 8405874  T
108 ttcgaaagcaacatca 123  Q
    ||  ||| ||||||||    
8405875 tttcaaaacaacatca 8405890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 73 - 104
Target Start/End: Original strand, 8361823 - 8361854
Alignment:
73 tatcaaccaaacaagtgttgcacaacaaatta 104  Q
    |||||||||||||||||||||||| |||||||    
8361823 tatcaaccaaacaagtgttgcacatcaaatta 8361854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University