View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852-Insertion-14 (Length: 123)
Name: NF5852-Insertion-14
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852-Insertion-14 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 3e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 9 - 123
Target Start/End: Original strand, 8405775 - 8405890
Alignment:
| Q |
9 |
tttaacagttcagatatgcaaaatgaat-gttgtacagccaaatcagatcgtcactaatgaatcgtatcaaccaaacaagtgttgcacaacaaattattt |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||| | |||| ||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
8405775 |
tttaacagttcagatatgcagaatgaattgctgtatagccaaatcagattgtcactaatgaattgtgtcaaccaaacaagtgttgcacaacaaattattt |
8405874 |
T |
|
| Q |
108 |
ttcgaaagcaacatca |
123 |
Q |
| |
|
|| ||| |||||||| |
|
|
| T |
8405875 |
tttcaaaacaacatca |
8405890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 73 - 104
Target Start/End: Original strand, 8361823 - 8361854
Alignment:
| Q |
73 |
tatcaaccaaacaagtgttgcacaacaaatta |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
8361823 |
tatcaaccaaacaagtgttgcacatcaaatta |
8361854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University