View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852-Insertion-16 (Length: 65)
Name: NF5852-Insertion-16
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852-Insertion-16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 1e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 9370445 - 9370389
Alignment:
| Q |
8 |
aacattggcatgcagctaataagaacataggttgctatcgagcattagttattatgg |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9370445 |
aacattggcatgcagctaataagaacataggttgctatcgagcattagttattatgg |
9370389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 9338684 - 9338647
Alignment:
| Q |
8 |
aacattggcatgcagctaataagaacataggttgctat |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9338684 |
aacattggcatgcagctaataagaacataggttgctat |
9338647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University