View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852_high_14 (Length: 397)
Name: NF5852_high_14
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 3e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 307 - 389
Target Start/End: Original strand, 49607086 - 49607168
Alignment:
| Q |
307 |
atctttactgatgtaaccgcaaaaccattttttatgtaatttccccgaaagtctttcatgtttcaattacaacatcctttgct |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49607086 |
atctttactgatgtaaccgcaaaaccattttttatgtaatttccccgaaagtctttcatgtttcaattacaacatcctttgct |
49607168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 49606780 - 49606875
Alignment:
| Q |
1 |
tgagctatgctcacatgactcaattttgcttatttaccttgacactaatgaataattggtattttatattattagtagttagtatacatgtcatca |
96 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49606780 |
tgagctatgcttacgggactcaattttgcttatttaccttgacactaatggataattggtattttatattactagtagttagtatacatgtcatca |
49606875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 204 - 241
Target Start/End: Original strand, 49606983 - 49607020
Alignment:
| Q |
204 |
ggaaaccctaattcctaaacctgttctcctttcgtaga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49606983 |
ggaaaccctaattcctaaacctgttctcctttcgtaga |
49607020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University