View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852_high_30 (Length: 241)
Name: NF5852_high_30
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852_high_30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 5522883 - 5522660
Alignment:
| Q |
18 |
caaaactgtcaccctttcttccaaacatgttcatcttagtcagaactgaatttagtttacctgaaaatataaaaatgaccatgataaatgaaattagttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5522883 |
caaaactgtcaccctttcttccaaacatgttcatcttagtcagaactgaatttagtttacctgaaaatataaaaatgaccatgatcaatgaaattagttt |
5522784 |
T |
 |
| Q |
118 |
ttaaaagaagtattcatgaattacagttttgttaatgtaggggtgtcaataccttgcctagattttgcaatggatttgctgtatacgccagaagaatccg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5522783 |
ttaaaagaagtattcatgaattacagttttgttaatgtaggggtgtcaataccttgcctagattttgcaatggatttgctgtatacgctagaagaatccg |
5522684 |
T |
 |
| Q |
218 |
gcaagtatctttttgacgacttcc |
241 |
Q |
| |
|
|||| ||||||||||| ||||||| |
|
|
| T |
5522683 |
gcaaatatctttttgatgacttcc |
5522660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 32 - 102
Target Start/End: Original strand, 51754073 - 51754143
Alignment:
| Q |
32 |
tttcttccaaacatgttcatcttagtcagaactgaatttagtttacctgaaaatataaaaatgaccatgat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
51754073 |
tttcttccaaacatgttcatcttagtcagaactgaatttaatttacctgaaaatagaaaaatgaccatgat |
51754143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University