View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852_high_31 (Length: 241)
Name: NF5852_high_31
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852_high_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 119 - 223
Target Start/End: Complemental strand, 38717757 - 38717653
Alignment:
| Q |
119 |
ttatgattacgggcatgaggccatcgaatttggaggattgaaccatcttgccaagacgaagcttctcggttgcaatgggactcttgcagcttctgcatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717757 |
ttatgattacgggcatgaggccatcgaatttggaggattgaaccatcttgccaagacgaagcttctcggttgcaatgggactcttgcagcttctgcatga |
38717658 |
T |
|
| Q |
219 |
cgaac |
223 |
Q |
| |
|
||||| |
|
|
| T |
38717657 |
cgaac |
38717653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 38717871 - 38717821
Alignment:
| Q |
1 |
taaaaatcaagaaattagtgaatgttgcaacttatgtaaacgtacattgat |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717871 |
taaaaatcaagaaattagtgaatgttgcaacttatgtaaacgtacattgat |
38717821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University