View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5852_high_38 (Length: 220)

Name: NF5852_high_38
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5852_high_38
NF5852_high_38
[»] chr4 (1 HSPs)
chr4 (18-202)||(32286909-32287094)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 32286909 - 32287094
Alignment:
18 ggtcttttgtttttagtgatatttctaaaatataattatcagaaattaattttcttttctctcaaatgagaagatagatgtggtggaaggaaacatgaaa 117  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32286909 ggtcttttctttttagtgatatttctaaaatataattatcagaaattaattttcttttctctcaaatgagaagatagatgtggtggaaggaaacatgaaa 32287008  T
118 ctgtagaatcc-acatgaaacaatgtccgagaagatcgaagcattgcttgcggctgcaagatatatatgattccaaggatgctcat 202  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
32287009 ctgtagaatccaacatgaaacaatgtccgagaagatcgaagcattgcttgcggctgcaagatatatatgattccaagggtgctcat 32287094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University