View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852_high_9 (Length: 449)
Name: NF5852_high_9
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 181 - 430
Target Start/End: Complemental strand, 37173085 - 37172836
Alignment:
| Q |
181 |
agttggccatagcaatggatgagtctactagaatatctcaaacactcaaatctgccacatctaaagtcgaaccctttcttcgttgctcggtgagggatgc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173085 |
agttggccatagcaatggatgagtctactagaatatctcaaacagtcaaatctgccacatctaaagtcgaaccctttcttcgttgctcggtgagggatgc |
37172986 |
T |
 |
| Q |
281 |
ttcgatttagtgttgcaacttcatcatcattttctgctttattcatggtaggtagtggttttaggatttgcttaatgattttatgactattttgatttta |
380 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37172985 |
ttcgatttagtgttgcaacttcatcttcattttctgctttattcatggtaggtagtggttttaggatttgcttaatgattttatgactattttgatttta |
37172886 |
T |
 |
| Q |
381 |
agacacttgtttcccaactcatgcatgacttgcacaatgacacattgaat |
430 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37172885 |
agacacttgtttcccaactcatgcaggacttgcacaatgacacattgaat |
37172836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 37173176 - 37173088
Alignment:
| Q |
18 |
ataactgctgcgcttgaggcaaagaagacacttacacaatttggcacgctataagagaaaagtgacaataatatgaggtccattgaaga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173176 |
ataactgctgcgcttgaggcaaagaagacacttacacaatttggcacgctataagagaaaagtgacaataatatgaggtccattgaaga |
37173088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University