View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852_low_23 (Length: 284)
Name: NF5852_low_23
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 59 - 214
Target Start/End: Complemental strand, 6697302 - 6697147
Alignment:
| Q |
59 |
ggaaccacatgaggttgttcttgagcacaactgcaaatgaaatgatgaatataattgatcttacactcataattgatcagcatatatagtttgaaatcga |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6697302 |
ggaaccacatgaggttgttcttgagcacaactgcaaatgaaatgatgaatacaattgatcttacactcataattgatcagcatatatagtttgaaatcga |
6697203 |
T |
|
| Q |
159 |
tgacatcacaatattgttatatctctaactcaaaatttgatacttgaatgtgtttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6697202 |
tgacatcacaatattgttatatctctaactcaaaatttaatacttgaatgtgtttg |
6697147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 269
Target Start/End: Complemental strand, 6697128 - 6697096
Alignment:
| Q |
237 |
atactagatctaaaatcaaattatcattcctat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6697128 |
atactagatctaaaatcaaattatcattcctat |
6697096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University