View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5852_low_23 (Length: 284)

Name: NF5852_low_23
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5852_low_23
NF5852_low_23
[»] chr6 (2 HSPs)
chr6 (59-214)||(6697147-6697302)
chr6 (237-269)||(6697096-6697128)


Alignment Details
Target: chr6 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 59 - 214
Target Start/End: Complemental strand, 6697302 - 6697147
Alignment:
59 ggaaccacatgaggttgttcttgagcacaactgcaaatgaaatgatgaatataattgatcttacactcataattgatcagcatatatagtttgaaatcga 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
6697302 ggaaccacatgaggttgttcttgagcacaactgcaaatgaaatgatgaatacaattgatcttacactcataattgatcagcatatatagtttgaaatcga 6697203  T
159 tgacatcacaatattgttatatctctaactcaaaatttgatacttgaatgtgtttg 214  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
6697202 tgacatcacaatattgttatatctctaactcaaaatttaatacttgaatgtgtttg 6697147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 269
Target Start/End: Complemental strand, 6697128 - 6697096
Alignment:
237 atactagatctaaaatcaaattatcattcctat 269  Q
    |||||||||||||||||||||||||||||||||    
6697128 atactagatctaaaatcaaattatcattcctat 6697096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University