View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5852_low_31 (Length: 241)

Name: NF5852_low_31
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5852_low_31
NF5852_low_31
[»] chr7 (2 HSPs)
chr7 (119-223)||(38717653-38717757)
chr7 (1-51)||(38717821-38717871)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 119 - 223
Target Start/End: Complemental strand, 38717757 - 38717653
Alignment:
119 ttatgattacgggcatgaggccatcgaatttggaggattgaaccatcttgccaagacgaagcttctcggttgcaatgggactcttgcagcttctgcatga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38717757 ttatgattacgggcatgaggccatcgaatttggaggattgaaccatcttgccaagacgaagcttctcggttgcaatgggactcttgcagcttctgcatga 38717658  T
219 cgaac 223  Q
    |||||    
38717657 cgaac 38717653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 38717871 - 38717821
Alignment:
1 taaaaatcaagaaattagtgaatgttgcaacttatgtaaacgtacattgat 51  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
38717871 taaaaatcaagaaattagtgaatgttgcaacttatgtaaacgtacattgat 38717821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University