View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5852_low_40 (Length: 212)
Name: NF5852_low_40
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5852_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 175
Target Start/End: Complemental strand, 41704099 - 41703940
Alignment:
| Q |
16 |
aatatctaatgattctctaattataactaacgttagctcacctcaatgtctagttattggtactcaataaaaaagaatgacattacaagaggtggtgtct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704099 |
aatatctaatgattctctaattataactaacgttagctcacctcaatgtctagttattggtactcaataaaaaagaatgacattacaagaggtggtgtct |
41704000 |
T |
|
| Q |
116 |
tcggattgtgtatagtgccaaggtaaacaagaggtggaatatcacttgttatgtattata |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41703999 |
tcggattgtgtatagtgccaaggtaaacaagaggtggaatatcacttgttatgtattata |
41703940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University