View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5853_low_24 (Length: 257)
Name: NF5853_low_24
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5853_low_24 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 257
Target Start/End: Original strand, 39478796 - 39479040
Alignment:
| Q |
13 |
aatatcatcatcattatcatcatgtaccttaatcgaaccaaaaaatttatcagcatacgatcttctaatggaatacggtttcccaatgggtcttcttcca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39478796 |
aatatcatcatcattatcatcatgtaccttaatcgaaccaaaaaatttatcagcatacgatcttctaatggaatacggtttcccaatgggtcttcttcca |
39478895 |
T |
 |
| Q |
113 |
aaaggagcaattgggtattcccttaacagagaaacaggtcaattttctgtgtatttcgagaaaacttgtagctttgttattgagagttatacacttagtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39478896 |
aaaggagcaattgggtattcccttaacagagaaacaggtcaattttctgtgtatttcgagaaaacttgtagctttgttattgagagttatacacttagtt |
39478995 |
T |
 |
| Q |
213 |
acaaatctactatcagtggtgtgatttcgcagaatagactttata |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39478996 |
acaaatctactatcagtggtgtgatttcgcagaatagactttata |
39479040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University