View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5853_low_25 (Length: 257)
Name: NF5853_low_25
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5853_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 35899831 - 35899591
Alignment:
| Q |
11 |
acctgtgtggatgagcacggaaacgttctatacggcttgagggaaacccatttaacgaggatcgttttatcaactccaaggaccttgttaagtcttcaga |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35899831 |
acctgtgtggatgagcatggaaacgttctatacgacttgagggaaacccatttaacgaggatcgttttatcaacaccaaggaccttgttaagtcttcaga |
35899732 |
T |
|
| Q |
111 |
cccgaggggtttgttaggtaatctttaagatttacttgtgcttatatttgatttgacgatttatttactgatttcgttgttttctcgtttgaagttaaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899731 |
cccgaggggtttgttaggtaatctttaagatttacttgtgcttatatttgatttgacgatttatttactgatttcgttgttttctcgtttgaagttaaca |
35899632 |
T |
|
| Q |
211 |
tggctggactacaagaaaagctgaagaaactaagtatgaag |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899631 |
tggctggactacaagaaaagctgaagaaactaagtatgaag |
35899591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University