View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5853_low_26 (Length: 255)
Name: NF5853_low_26
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5853_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 28926408 - 28926645
Alignment:
| Q |
1 |
atataaatccccttgaaagacaaaatagaaacaataatgtagttaactgcagaaaaaataatcttaaacatgcaatctaactgatagaaagattttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
28926408 |
atataaatccccttgaaagacaaaatagaaacaataatgtagttaactgcagaaaaaataatcttaaacatgcaatctaactaatagaaagatttcttat |
28926507 |
T |
 |
| Q |
101 |
gg--aaagtgttggtttatggaatctatgtttcgaggactctcttgattccaa-ctcttagcaatgcttctgcatctcagattcctcttgcttttgtatc |
197 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28926508 |
ggaaaaagtgttggtttatggaatctatgtttcgaggactctcttgattccaatctcttagcaatgcttctgcatctcagattcctcttgcttttgtatc |
28926607 |
T |
 |
| Q |
198 |
ttccaccttgctttttctgcaaaacccaacatctataa |
235 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28926608 |
tcccaccttgctttttctgtaaaacccaacatctataa |
28926645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 235
Target Start/End: Complemental strand, 7120370 - 7120270
Alignment:
| Q |
136 |
actctcttgattccaa-ctcttagcaatgcttctgcatctcagattcctcttgcttttgtatcttccaccttgctttttctgcaaaacccaacatctata |
234 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||||||| || |||| || |||||||||| ||| | ||| ||||||||||||| |||||| |||| |
|
|
| T |
7120370 |
actctcctgattccaatctcttagcaaaacttctgcatcacaaattcttccaacttttgtatccaccatcatgccttttctgcaaaactcaacatgtata |
7120271 |
T |
 |
| Q |
235 |
a |
235 |
Q |
| |
|
| |
|
|
| T |
7120270 |
a |
7120270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University