View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5853_low_27 (Length: 252)
Name: NF5853_low_27
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5853_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 23 - 238
Target Start/End: Complemental strand, 1077018 - 1076803
Alignment:
| Q |
23 |
tggacccacgatttaggatatgtaaagtcgttatttaatcgtgtcttccatatttgggtattgacaacctacaagatatagcatcttcatcagtggtatc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1077018 |
tggacccacgatttaggatatgtaaagtctttatttaattgtgtcttccatatttgggtattgacaacctacaagatatagcatcttcatcagtggtatc |
1076919 |
T |
 |
| Q |
123 |
taagcggaaccaacattcttggattcaataaggatatcatgaaatgggattacttggataagcattttctttgacatatcattctaaggttgagatacaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1076918 |
taagcggaaccaacattcttggattcaataaggatatcatgaaatgggattacttggataagcattttctttgacatatcattctaaggttgagatacaa |
1076819 |
T |
 |
| Q |
223 |
agtttgtgaaattttt |
238 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1076818 |
agtttgtgaaattttt |
1076803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University