View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5853_low_30 (Length: 248)
Name: NF5853_low_30
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5853_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 28926172 - 28926351
Alignment:
| Q |
1 |
aaatgacctcaaaatgtacttgtgctatgtaatgt-cataaatattagtaaatgttgtacagaacaannnnnnnctctcactcaattaacagcaatctca |
99 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| | |
|
|
| T |
28926172 |
aaatgacttcaaaatgtacctgtgctatgtaatgtacataaatattagtaaatgttgtacagaacaatttttttctctcactccattaacagcaatctaa |
28926271 |
T |
 |
| Q |
100 |
agaaacacaagagtaatgacaactaataaacagatagttggatataagagactctgataaaaatcacaccagctttccca |
179 |
Q |
| |
|
|||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28926272 |
agaaacacgagagtaaagacaactaacaaacagatagttggatataagagactctgatacaaatcacaccagctttccca |
28926351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University