View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5853_low_42 (Length: 216)
Name: NF5853_low_42
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5853_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 37169968 - 37170168
Alignment:
| Q |
1 |
caatgcgcagggaaagcattggcacctctagtttccgccgtctctcattcgaccttctccctccttcaccggatagtctcgccctcaaaccccaccgcgc |
100 |
Q |
| |
|
||||| |||| ||||||||| ||| | |||||||| ||||||| |||||||||||||| |||||||||||||| |||||| |||||||||| |||||| | |
|
|
| T |
37169968 |
caatgagcagtgaaagcatttgcagcactagtttcagccgtctttcattcgaccttcttcctccttcaccggagagtctctccctcaaacctcaccgctc |
37170067 |
T |
 |
| Q |
101 |
ctccgacttcgcttactccgccatccgtcgcaagtccgctctcacatttcgtgacttccacctcctccgccgtatcggcgccggagatatcggtactgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170068 |
ctccgacttcgcttactccgccatccgtcgcaagtccgctctcacatttcgtgacttccacctcctccgccgtatcggcgccggagatatcggtactgtt |
37170167 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
37170168 |
t |
37170168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 100 - 184
Target Start/End: Complemental strand, 6073702 - 6073621
Alignment:
| Q |
100 |
cctccgacttcgcttactccgccatccgtcgcaagtccgctctcacatttcgtgacttccacctcctccgccgtatcggcgccgg |
184 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||| |||| ||||| || ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
6073702 |
cctccgacttcgcctacaccgccatccg---caaatccggcctcaccttccgtgacttccatctcctccgccgtataggcgccgg |
6073621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University