View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5853_low_44 (Length: 204)
Name: NF5853_low_44
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5853_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 24067592 - 24067770
Alignment:
| Q |
17 |
catggatagatacaatgtagctcggttaattggagcacctcctggctatatcggttttgatgatggcggtcaattaaccgaagctattcggaaaaattca |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24067592 |
catggatagatacaatgtagctaggttaattggagcacctcctggctatatcggttttgatgatggcggtcaattaaccgaagctattcggaaaaattca |
24067691 |
T |
|
| Q |
117 |
catgcagttgttttatttgatgagattgaaaaagcacattcagatgttttcaacttaatgctacaaattcttgatgatg |
195 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24067692 |
catgcagttgttttgtttgatgagattgaaaaagcacattcagatgttttcaacttaatgctacaaattcttgatgatg |
24067770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 118 - 195
Target Start/End: Complemental strand, 3514698 - 3514621
Alignment:
| Q |
118 |
atgcagttgttttatttgatgagattgaaaaagcacattcagatgttttcaacttaatgctacaaattcttgatgatg |
195 |
Q |
| |
|
|||| ||| ||||||||||||||||||| || |||||||| ||||| |||||| || | || |||||| | ||||||| |
|
|
| T |
3514698 |
atgctgttattttatttgatgagattgagaaggcacattcggatgtcttcaacgtattccttcaaattttagatgatg |
3514621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University