View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5854-Insertion-11 (Length: 213)
Name: NF5854-Insertion-11
Description: NF5854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5854-Insertion-11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 9 - 185
Target Start/End: Original strand, 22986255 - 22986427
Alignment:
| Q |
9 |
atcatcaccatttttctggccataatccaccgttataacactgctgcgcgcggttccgccatgtcctttgactggtaggctgaatttgctgccccgacag |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
22986255 |
atcatcaccatttttctggcca----ccaccgttataacactgctgcgcgcggttcaaccatgtcctttgactggtaggatgaatttgctgccccgatag |
22986350 |
T |
|
| Q |
109 |
ctccctcttcttcaacgtagttgcagcctccaccttcagctgcggttccaccaccattcaggtcatttgcacaggtt |
185 |
Q |
| |
|
||||||||||| || ||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22986351 |
ctccctcttctgcagcgtgggtgcagcctccaccttcagctgcggttccaccaccatttaggtcatttgcacaggtt |
22986427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University